Review



pgfp n1 plasmid  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TaKaRa pgfp n1 plasmid
    Pgfp N1 Plasmid, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 385 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgfp+n1+plasmid/pGFP+Vector/pmc09972913-209-7-9
    Average 94 stars, based on 385 article reviews
    pgfp n1 plasmid - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Control:

    Article Title: CP204L Is a Multifunctional Protein of African Swine Fever Virus That Interacts with the VPS39 Subunit of the Homotypic Fusion and Vacuole Protein Sorting Complex and Promotes Lysosome Clustering
    Article Snippet: .. (i) Control plasmids (GFP and empty vector). pGFP-N1 plasmid (Clontech; GenBank accession no. U55762 ) was used for GFP expression. .. To obtain a matching control plasmid for transfection experiments, a 741-bp BamHI/NotI fragment containing the open reading frame (ORF) encoding the enhanced GFP was deleted from pGFP-N1 (Clontech; GenBank accession no. U55762 ), resulting in pΔGFP-N1 after Klenow treatment and ligation. (ii) CP204L-GFP plasmid.

    Plasmid Preparation:

    Article Title: CP204L Is a Multifunctional Protein of African Swine Fever Virus That Interacts with the VPS39 Subunit of the Homotypic Fusion and Vacuole Protein Sorting Complex and Promotes Lysosome Clustering
    Article Snippet: .. (i) Control plasmids (GFP and empty vector). pGFP-N1 plasmid (Clontech; GenBank accession no. U55762 ) was used for GFP expression. .. To obtain a matching control plasmid for transfection experiments, a 741-bp BamHI/NotI fragment containing the open reading frame (ORF) encoding the enhanced GFP was deleted from pGFP-N1 (Clontech; GenBank accession no. U55762 ), resulting in pΔGFP-N1 after Klenow treatment and ligation. (ii) CP204L-GFP plasmid.

    Article Title: Replicative transposon system
    Article Snippet: Mol Ther 18, 1200-1209 (2010)) vector into the SpeI site of the pHelR and pHelRΔHP vectors, respectively Mol Ther 18, 1200-1209 (2010)) vector into the SpeI site of the pHelR and pHelRΔHP vectors, respectively. .. To generate the Helitron circle donor plasmid pHelRCD, first pIRES-EGFP-N1 vector was constructed by cloning the NotI/BamHI fragment of pWAS-EGFP into the NotI/BamHI sites of the pGFP-N1 plasmid (Clontech). ..

    Article Title: Tumor Intracellular‐Environment Responsive Materials Shielded Nano‐Complexes for Highly Efficient Light‐Triggered Gene Delivery without Cargo Gene Damage
    Article Snippet: © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 3472 wileyonlinelibrary.com both gene and chemotherapeutic delivery because the uptake of foreign materials usually relies on the cell’s innate endocytic uptake mechanism.. [ 6 ] This endocytic uptake pathway ultimately leads to the degradation of the drugs by fusion with a lysosomal compartment, which has harsh acidic and degradative lysosomal enzymes.. [ 7 ] Poor tissue penetration is another signifi cant drawback of nanoparticle-based gene delivery, which results in low therapeutic effi cacy and poor biodistribution.

    Article Title: Fluorescent proteins
    Article Snippet: .. The GFP allele present in the pGFP-N1 plasmid (available from Clontech Laboratories) was introduced into the IPTG inducible E.coli expression vector in the following manner: 1 ng pGFP-N1 plasmid DNA was used as template in a standard PCR reaction where the 5′ PCR primer had the sequence: (SEQ ID NO:11) 5′- TGGAATAAGCTTTATGAGTAAAGGAGAAGAACTTTT - 3′ and the 3′ PCR primer had the sequence: (SEQ ID NO:12) 5′ - GAATCGTAGATCTTTATTTGTATAGTTCATCCATG - 3′. ..

    Article Title: CP204L Is a Multifunctional Protein of African Swine Fever Virus That Interacts with The VPS39 Subunit of HOPS Complex and Promotes Lysosome Clustering
    Article Snippet: .. The plasmid pUC-BaKJCAG-CP204Lsyn used for CP204L expression was previously described ( ). pGFP-N1 plasmid (Clontech, GenBank accession # U55762 ) was used for GFP expression. ..

    Article Title: Class II ADP-ribosylation Factors Are Required for Efficient Secretion of Dengue Viruses
    Article Snippet: For the construction of GFP fusion proteins, Arf4 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_001660","term_id":"187608297","term_text":"NM_001660"}} NM_001660 ) and Arf5 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_001662","term_id":"313760590","term_text":"NM_001662"}} NM_001662 ) cDNAs were purchased from OriGene Technologies (Rockville, MD). .. A GFP cDNA derived from the pGFP-N1 plasmid (Clontech) was fused to the C-terminal end of Arf4 and Arf5 and subcloned into pcDNA3.1 (Invitrogen). ..

    Article Title: Gene delivery mediated by liposome-DNA complex with cleavable peg surface modification
    Article Snippet: .. No. 5,851,818 from two commercially available plasmids, pGFP-N1 plasmid (Clontech, Palo Alto, Calif.) and pGL3-C (Promega Corporation, Madison, Wis.). ..

    Article Title: Bone marrow-derived mesenchymal stromal cells express cardiac-specific markers, retain the stromal phenotype, and do not become functional cardiomyocytes in vitro.
    Article Snippet: A 5.5-kilobase promoter sequence was excised by BamHI and ScalI and subcloned into pBluescriptIIKS (Stratagene, La Jolla, CA, http://www.stratagene.com) to generate pKS-MHC. .. A PGFP-N1 plasmid (Clontech, Palo Alto, CA, http://www.clontech.com) was used to excise a 0.76-kilobase GFP full coding sequence using ScalI and NotI. ..

    Expressing:

    Article Title: CP204L Is a Multifunctional Protein of African Swine Fever Virus That Interacts with the VPS39 Subunit of the Homotypic Fusion and Vacuole Protein Sorting Complex and Promotes Lysosome Clustering
    Article Snippet: .. (i) Control plasmids (GFP and empty vector). pGFP-N1 plasmid (Clontech; GenBank accession no. U55762 ) was used for GFP expression. .. To obtain a matching control plasmid for transfection experiments, a 741-bp BamHI/NotI fragment containing the open reading frame (ORF) encoding the enhanced GFP was deleted from pGFP-N1 (Clontech; GenBank accession no. U55762 ), resulting in pΔGFP-N1 after Klenow treatment and ligation. (ii) CP204L-GFP plasmid.

    Article Title: Fluorescent proteins
    Article Snippet: .. The GFP allele present in the pGFP-N1 plasmid (available from Clontech Laboratories) was introduced into the IPTG inducible E.coli expression vector in the following manner: 1 ng pGFP-N1 plasmid DNA was used as template in a standard PCR reaction where the 5′ PCR primer had the sequence: (SEQ ID NO:11) 5′- TGGAATAAGCTTTATGAGTAAAGGAGAAGAACTTTT - 3′ and the 3′ PCR primer had the sequence: (SEQ ID NO:12) 5′ - GAATCGTAGATCTTTATTTGTATAGTTCATCCATG - 3′. ..

    Article Title: CP204L Is a Multifunctional Protein of African Swine Fever Virus That Interacts with The VPS39 Subunit of HOPS Complex and Promotes Lysosome Clustering
    Article Snippet: .. The plasmid pUC-BaKJCAG-CP204Lsyn used for CP204L expression was previously described ( ). pGFP-N1 plasmid (Clontech, GenBank accession # U55762 ) was used for GFP expression. ..

    Construct:

    Article Title: Replicative transposon system
    Article Snippet: Mol Ther 18, 1200-1209 (2010)) vector into the SpeI site of the pHelR and pHelRΔHP vectors, respectively Mol Ther 18, 1200-1209 (2010)) vector into the SpeI site of the pHelR and pHelRΔHP vectors, respectively. .. To generate the Helitron circle donor plasmid pHelRCD, first pIRES-EGFP-N1 vector was constructed by cloning the NotI/BamHI fragment of pWAS-EGFP into the NotI/BamHI sites of the pGFP-N1 plasmid (Clontech). ..

    Cloning:

    Article Title: Replicative transposon system
    Article Snippet: Mol Ther 18, 1200-1209 (2010)) vector into the SpeI site of the pHelR and pHelRΔHP vectors, respectively Mol Ther 18, 1200-1209 (2010)) vector into the SpeI site of the pHelR and pHelRΔHP vectors, respectively. .. To generate the Helitron circle donor plasmid pHelRCD, first pIRES-EGFP-N1 vector was constructed by cloning the NotI/BamHI fragment of pWAS-EGFP into the NotI/BamHI sites of the pGFP-N1 plasmid (Clontech). ..

    Polymerase Chain Reaction:

    Article Title: Fluorescent proteins
    Article Snippet: .. The GFP allele present in the pGFP-N1 plasmid (available from Clontech Laboratories) was introduced into the IPTG inducible E.coli expression vector in the following manner: 1 ng pGFP-N1 plasmid DNA was used as template in a standard PCR reaction where the 5′ PCR primer had the sequence: (SEQ ID NO:11) 5′- TGGAATAAGCTTTATGAGTAAAGGAGAAGAACTTTT - 3′ and the 3′ PCR primer had the sequence: (SEQ ID NO:12) 5′ - GAATCGTAGATCTTTATTTGTATAGTTCATCCATG - 3′. ..

    Sequencing:

    Article Title: Fluorescent proteins
    Article Snippet: .. The GFP allele present in the pGFP-N1 plasmid (available from Clontech Laboratories) was introduced into the IPTG inducible E.coli expression vector in the following manner: 1 ng pGFP-N1 plasmid DNA was used as template in a standard PCR reaction where the 5′ PCR primer had the sequence: (SEQ ID NO:11) 5′- TGGAATAAGCTTTATGAGTAAAGGAGAAGAACTTTT - 3′ and the 3′ PCR primer had the sequence: (SEQ ID NO:12) 5′ - GAATCGTAGATCTTTATTTGTATAGTTCATCCATG - 3′. ..

    Article Title: Bone marrow-derived mesenchymal stromal cells express cardiac-specific markers, retain the stromal phenotype, and do not become functional cardiomyocytes in vitro.
    Article Snippet: A 5.5-kilobase promoter sequence was excised by BamHI and ScalI and subcloned into pBluescriptIIKS (Stratagene, La Jolla, CA, http://www.stratagene.com) to generate pKS-MHC. .. A PGFP-N1 plasmid (Clontech, Palo Alto, CA, http://www.clontech.com) was used to excise a 0.76-kilobase GFP full coding sequence using ScalI and NotI. ..

    Derivative Assay:

    Article Title: Class II ADP-ribosylation Factors Are Required for Efficient Secretion of Dengue Viruses
    Article Snippet: For the construction of GFP fusion proteins, Arf4 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_001660","term_id":"187608297","term_text":"NM_001660"}} NM_001660 ) and Arf5 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_001662","term_id":"313760590","term_text":"NM_001662"}} NM_001662 ) cDNAs were purchased from OriGene Technologies (Rockville, MD). .. A GFP cDNA derived from the pGFP-N1 plasmid (Clontech) was fused to the C-terminal end of Arf4 and Arf5 and subcloned into pcDNA3.1 (Invitrogen). ..



    Similar Products

    94
    TaKaRa pgfp n1 plasmid
    Pgfp N1 Plasmid, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgfp+n1+plasmid/pGFP+Vector/pmc09972913-209-7-9
    Average 94 stars, based on 1 article reviews
    pgfp n1 plasmid - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    95
    Addgene inc pgfp n1
    Pgfp N1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgfp+n1+plasmid/mCherry-hLC3B-pcDNA3%2E1+(Plasmid+%2340827)/pmc09278890-103-50-53
    Average 95 stars, based on 1 article reviews
    pgfp n1 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    90
    Genechem 4.7-kb plasmid encoding green fluorescence protein (pgfp-n1)
    4.7 Kb Plasmid Encoding Green Fluorescence Protein (Pgfp N1), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgfp+n1+plasmid/4+7+kb+plasmid+encoding+green+fluorescence+protein++pgfp+n1+/pmc07968241-187-10-22
    Average 90 stars, based on 1 article reviews
    4.7-kb plasmid encoding green fluorescence protein (pgfp-n1) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    BioSignal Group plasmids pgfp 2 -n1
    Determination of complex formation between CYP1A2 and HO-1—Effect of POR . A , HEK 293T/17 cells were transfected <t>with</t> <t>plasmids</t> coding for rabbit CYP1A2-GFP, Rluc-HO-1, in the absence and presence of untagged-POR. The CYP1A2-GFP–Rluc-HO-1 <t>BRET</t> pair was measured 24 h after transfection in the absence ( blue ) and presence ( red ) of 500 ng of cotransfected POR DNA. Error bars represent the standard deviation (SD) of triplicate measurements of cells from a single transfection and generally do not exceed the size of the points. The experiment was performed three times with small adjustments to transfection conditions for optimization of protein expression levels. Results from each transfection were consistent. B , total protein expression was estimated from the sum of the fluorescence of the GFP and luminescence of the Rluc tags, using a GFP–Rluc fusion protein as a standard. C , effect of changes in protein concentration at a fixed ratio of GFP-CYP1A2 to Rluc-HO-1. HEK 293T/17 cells were transfected with different amounts of DNA, while maintaining an excess of the CYP1A2-GFP–tagged protein. The relative levels of GFP–Rluc protein expression were in excess of 38:1. BRET, bioluminescence resonance energy transfer; GFP, green fluorescent protein; HO-1, heme oxygenase 1; POR, NADPH-cytochrome P450 reductase.
    Plasmids Pgfp 2 N1, supplied by BioSignal Group, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgfp+n1+plasmid/prluc+n1/pmc07948974-168-5-24
    Average 90 stars, based on 1 article reviews
    plasmids pgfp 2 -n1 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Determination of complex formation between CYP1A2 and HO-1—Effect of POR . A , HEK 293T/17 cells were transfected with plasmids coding for rabbit CYP1A2-GFP, Rluc-HO-1, in the absence and presence of untagged-POR. The CYP1A2-GFP–Rluc-HO-1 BRET pair was measured 24 h after transfection in the absence ( blue ) and presence ( red ) of 500 ng of cotransfected POR DNA. Error bars represent the standard deviation (SD) of triplicate measurements of cells from a single transfection and generally do not exceed the size of the points. The experiment was performed three times with small adjustments to transfection conditions for optimization of protein expression levels. Results from each transfection were consistent. B , total protein expression was estimated from the sum of the fluorescence of the GFP and luminescence of the Rluc tags, using a GFP–Rluc fusion protein as a standard. C , effect of changes in protein concentration at a fixed ratio of GFP-CYP1A2 to Rluc-HO-1. HEK 293T/17 cells were transfected with different amounts of DNA, while maintaining an excess of the CYP1A2-GFP–tagged protein. The relative levels of GFP–Rluc protein expression were in excess of 38:1. BRET, bioluminescence resonance energy transfer; GFP, green fluorescent protein; HO-1, heme oxygenase 1; POR, NADPH-cytochrome P450 reductase.

    Journal: The Journal of Biological Chemistry

    Article Title: Heme oxygenase-1 affects cytochrome P450 function through the formation of heteromeric complexes: Interactions between CYP1A2 and heme oxygenase-1

    doi: 10.1074/jbc.RA120.015911

    Figure Lengend Snippet: Determination of complex formation between CYP1A2 and HO-1—Effect of POR . A , HEK 293T/17 cells were transfected with plasmids coding for rabbit CYP1A2-GFP, Rluc-HO-1, in the absence and presence of untagged-POR. The CYP1A2-GFP–Rluc-HO-1 BRET pair was measured 24 h after transfection in the absence ( blue ) and presence ( red ) of 500 ng of cotransfected POR DNA. Error bars represent the standard deviation (SD) of triplicate measurements of cells from a single transfection and generally do not exceed the size of the points. The experiment was performed three times with small adjustments to transfection conditions for optimization of protein expression levels. Results from each transfection were consistent. B , total protein expression was estimated from the sum of the fluorescence of the GFP and luminescence of the Rluc tags, using a GFP–Rluc fusion protein as a standard. C , effect of changes in protein concentration at a fixed ratio of GFP-CYP1A2 to Rluc-HO-1. HEK 293T/17 cells were transfected with different amounts of DNA, while maintaining an excess of the CYP1A2-GFP–tagged protein. The relative levels of GFP–Rluc protein expression were in excess of 38:1. BRET, bioluminescence resonance energy transfer; GFP, green fluorescent protein; HO-1, heme oxygenase 1; POR, NADPH-cytochrome P450 reductase.

    Article Snippet: The plasmids used to generate BRET vectors (pGFP 2 -N1, pGFP 2 -N2, pRluc-N2, pRluc-N3) and the pGFP 2 -Rluc vector were obtained from BioSignal Packard (Waltham, WA).

    Techniques: Transfection, Standard Deviation, Expressing, Fluorescence, Protein Concentration, Bioluminescence Resonance Energy Transfer

    Effect of HO-1 on the interaction between CYP1A2-GFP and POR-Rluc. A , HEK 293T/17 cells were transfected with plasmids coding for rabbit CYP1A2-GFP and POR-Rluc in the absence and presence of 500 ng of unlabeled HO-1. Twenty-four hours post transfection, cells were collected and BRET was measured. When cells were cotransfected with HO-1 DNA, the maximum BRET signal generated was significantly lower ( red ) than that of cells transfected with the CYP1A2-GFP•POR-Rluc pair alone ( blue ). Data points represent triplicate measurements of cells from a single transfection; error bars represent the standard deviation (SD) and generally did not exceed the size of the points. Each experiment was repeated with small adjustments to transfection conditions for optimization of protein expression. Results were both transfections were consistent. B , total protein expression was estimated from the sum of the fluorescence of the GFP and luminescence of the Rluc tags. BRET, bioluminescence resonance energy transfer; GFP, green fluorescent protein; HO-1, heme oxygenase 1; POR, NADPH-cytochrome P450 reductase.

    Journal: The Journal of Biological Chemistry

    Article Title: Heme oxygenase-1 affects cytochrome P450 function through the formation of heteromeric complexes: Interactions between CYP1A2 and heme oxygenase-1

    doi: 10.1074/jbc.RA120.015911

    Figure Lengend Snippet: Effect of HO-1 on the interaction between CYP1A2-GFP and POR-Rluc. A , HEK 293T/17 cells were transfected with plasmids coding for rabbit CYP1A2-GFP and POR-Rluc in the absence and presence of 500 ng of unlabeled HO-1. Twenty-four hours post transfection, cells were collected and BRET was measured. When cells were cotransfected with HO-1 DNA, the maximum BRET signal generated was significantly lower ( red ) than that of cells transfected with the CYP1A2-GFP•POR-Rluc pair alone ( blue ). Data points represent triplicate measurements of cells from a single transfection; error bars represent the standard deviation (SD) and generally did not exceed the size of the points. Each experiment was repeated with small adjustments to transfection conditions for optimization of protein expression. Results were both transfections were consistent. B , total protein expression was estimated from the sum of the fluorescence of the GFP and luminescence of the Rluc tags. BRET, bioluminescence resonance energy transfer; GFP, green fluorescent protein; HO-1, heme oxygenase 1; POR, NADPH-cytochrome P450 reductase.

    Article Snippet: The plasmids used to generate BRET vectors (pGFP 2 -N1, pGFP 2 -N2, pRluc-N2, pRluc-N3) and the pGFP 2 -Rluc vector were obtained from BioSignal Packard (Waltham, WA).

    Techniques: Transfection, Generated, Standard Deviation, Expressing, Fluorescence, Bioluminescence Resonance Energy Transfer

    Effect of CYP1A2 on the interaction between GFP-HO-1 and POR-Rluc. A , HEK 293T/17 cells were transfected with plasmids coding for GFP-HO-1 and POR-Rluc in the absence and presence of untagged CYP1A2. BRET generated by the GFP-HO-1•POR-Rluc pair was measured 24 h after transfection in the presence ( red ) and absence ( blue ) of 2 μg of vector coding for untagged CYP1A2. Cotransfected CYP1A2 DNA did not significantly alter the BRET signal generated by the GFP-HO-1•POR-Rluc pair. Error bars represent the SD of triplicate measurements of cells from a single transfection and generally do not exceed the size of the points. Each experiment was repeated with small adjustments to transfection conditions for optimization of protein expression, generating similar results. B , total protein expression was estimated from the sum of the fluorescence of the GFP and luminescence of the Rluc tags. BRET, bioluminescence resonance energy transfer; GFP, green fluorescent protein; HO-1, heme oxygenase 1; POR, NADPH-cytochrome P450 reductase.

    Journal: The Journal of Biological Chemistry

    Article Title: Heme oxygenase-1 affects cytochrome P450 function through the formation of heteromeric complexes: Interactions between CYP1A2 and heme oxygenase-1

    doi: 10.1074/jbc.RA120.015911

    Figure Lengend Snippet: Effect of CYP1A2 on the interaction between GFP-HO-1 and POR-Rluc. A , HEK 293T/17 cells were transfected with plasmids coding for GFP-HO-1 and POR-Rluc in the absence and presence of untagged CYP1A2. BRET generated by the GFP-HO-1•POR-Rluc pair was measured 24 h after transfection in the presence ( red ) and absence ( blue ) of 2 μg of vector coding for untagged CYP1A2. Cotransfected CYP1A2 DNA did not significantly alter the BRET signal generated by the GFP-HO-1•POR-Rluc pair. Error bars represent the SD of triplicate measurements of cells from a single transfection and generally do not exceed the size of the points. Each experiment was repeated with small adjustments to transfection conditions for optimization of protein expression, generating similar results. B , total protein expression was estimated from the sum of the fluorescence of the GFP and luminescence of the Rluc tags. BRET, bioluminescence resonance energy transfer; GFP, green fluorescent protein; HO-1, heme oxygenase 1; POR, NADPH-cytochrome P450 reductase.

    Article Snippet: The plasmids used to generate BRET vectors (pGFP 2 -N1, pGFP 2 -N2, pRluc-N2, pRluc-N3) and the pGFP 2 -Rluc vector were obtained from BioSignal Packard (Waltham, WA).

    Techniques: Transfection, Generated, Plasmid Preparation, Expressing, Fluorescence, Bioluminescence Resonance Energy Transfer

    Effect of HO-1 on formation of the homomeric CYP1A2 BRET complex. A , HEK 293T/17 cells were transfected with plasmids coding for CYP1A2-GFP and CYP1A2-Rluc in the absence and presence of untagged HO-1. BRET generated by the CYP1A2-GFP•CYP1A2-Rluc pair was measured 24 h after transfection with ( red ) and without ( blue ) 2000 ng of a vector coding for untagged HO-1. Cotransfected HO-1 DNA led to a significant disruption of the BRET signal generated by the CYP1A2-GFP•CYP1A2-Rluc pair. Error bars represent the standard deviation (SD) of triplicate measurements of cells from a single transfection and do not exceed the size of the data points. Each experiment was repeated with small adjustments to transfection conditions for optimization of protein expression, generating similar results. B , total protein expression was estimated from the sum of the fluorescence of the GFP and luminescence of the Rluc tags. BRET, bioluminescence resonance energy transfer; GFP, green fluorescent protein; HO-1, heme oxygenase 1.

    Journal: The Journal of Biological Chemistry

    Article Title: Heme oxygenase-1 affects cytochrome P450 function through the formation of heteromeric complexes: Interactions between CYP1A2 and heme oxygenase-1

    doi: 10.1074/jbc.RA120.015911

    Figure Lengend Snippet: Effect of HO-1 on formation of the homomeric CYP1A2 BRET complex. A , HEK 293T/17 cells were transfected with plasmids coding for CYP1A2-GFP and CYP1A2-Rluc in the absence and presence of untagged HO-1. BRET generated by the CYP1A2-GFP•CYP1A2-Rluc pair was measured 24 h after transfection with ( red ) and without ( blue ) 2000 ng of a vector coding for untagged HO-1. Cotransfected HO-1 DNA led to a significant disruption of the BRET signal generated by the CYP1A2-GFP•CYP1A2-Rluc pair. Error bars represent the standard deviation (SD) of triplicate measurements of cells from a single transfection and do not exceed the size of the data points. Each experiment was repeated with small adjustments to transfection conditions for optimization of protein expression, generating similar results. B , total protein expression was estimated from the sum of the fluorescence of the GFP and luminescence of the Rluc tags. BRET, bioluminescence resonance energy transfer; GFP, green fluorescent protein; HO-1, heme oxygenase 1.

    Article Snippet: The plasmids used to generate BRET vectors (pGFP 2 -N1, pGFP 2 -N2, pRluc-N2, pRluc-N3) and the pGFP 2 -Rluc vector were obtained from BioSignal Packard (Waltham, WA).

    Techniques: Transfection, Generated, Plasmid Preparation, Disruption, Standard Deviation, Expressing, Fluorescence, Bioluminescence Resonance Energy Transfer

    Description of the  BRET  constructs and their restriction sites

    Journal: The Journal of Biological Chemistry

    Article Title: Heme oxygenase-1 affects cytochrome P450 function through the formation of heteromeric complexes: Interactions between CYP1A2 and heme oxygenase-1

    doi: 10.1074/jbc.RA120.015911

    Figure Lengend Snippet: Description of the BRET constructs and their restriction sites

    Article Snippet: The plasmids used to generate BRET vectors (pGFP 2 -N1, pGFP 2 -N2, pRluc-N2, pRluc-N3) and the pGFP 2 -Rluc vector were obtained from BioSignal Packard (Waltham, WA).

    Techniques: Construct, Plasmid Preparation, Sequencing